ID: 1184543798_1184543809

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1184543798 1184543809
Species Human (GRCh38) Human (GRCh38)
Location 22:45151256-45151278 22:45151300-45151322
Sequence CCCTGTCTCCAAATGCAATCCCA ACTTCAAAAGATGAATTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 54, 3: 338, 4: 1251} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!