ID: 1184565179_1184565182

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1184565179 1184565182
Species Human (GRCh38) Human (GRCh38)
Location 22:45287499-45287521 22:45287551-45287573
Sequence CCTGATGAGGGAGAGCAGGGGCA TTATATGCTGAGAACATCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 316} {0: 1, 1: 0, 2: 0, 3: 7, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!