ID: 1184568775_1184568791

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1184568775 1184568791
Species Human (GRCh38) Human (GRCh38)
Location 22:45309600-45309622 22:45309645-45309667
Sequence CCGCCCCCTTTCTGCAAATGAGG GGCCAGGTAGGGCTAGGACGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 253} {0: 1, 1: 0, 2: 3, 3: 12, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!