ID: 1184571416_1184571429 |
View in Genome Browser |
Spacer: 29 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1184571416 | 1184571429 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 22:45327417-45327439 | 22:45327469-45327491 |
Sequence | CCCCTCACTCCTCTCCTGCCTCC | GAGCCGTGACCTCAGTGCTGTGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 2, 2: 24, 3: 281, 4: 2118} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |