ID: 1184580328_1184580332

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1184580328 1184580332
Species Human (GRCh38) Human (GRCh38)
Location 22:45412956-45412978 22:45412976-45412998
Sequence CCAGGGCCAAGGGCAAGAGCAGT AGTCCCCGAAGCAGGAGTGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!