ID: 1184620415_1184620430

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1184620415 1184620430
Species Human (GRCh38) Human (GRCh38)
Location 22:45672224-45672246 22:45672265-45672287
Sequence CCGGGACTCCCGCGGCGGCCCCG CCCCCGCCTCGCTGGAGACGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 240} {0: 1, 1: 0, 2: 0, 3: 22, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!