ID: 1184670099_1184670106

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1184670099 1184670106
Species Human (GRCh38) Human (GRCh38)
Location 22:46007822-46007844 22:46007848-46007870
Sequence CCGCCAAGCCTCCGGCCTGAAGT GCTCCTGTTCTCAGCCTGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 25, 4: 327}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!