ID: 1184712796_1184712804

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1184712796 1184712804
Species Human (GRCh38) Human (GRCh38)
Location 22:46263011-46263033 22:46263064-46263086
Sequence CCAGGGCAGGCGTTGGGCGCTGA GCCGCCCGGTCCCGCCATGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 140} {0: 1, 1: 0, 2: 1, 3: 12, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!