ID: 1184723710_1184723721

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1184723710 1184723721
Species Human (GRCh38) Human (GRCh38)
Location 22:46331043-46331065 22:46331086-46331108
Sequence CCTGAGACACACCCCTTGAGAAG GGGTATGAGTGGAAAGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 235} {0: 1, 1: 0, 2: 9, 3: 58, 4: 632}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!