ID: 1184724385_1184724391

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1184724385 1184724391
Species Human (GRCh38) Human (GRCh38)
Location 22:46335256-46335278 22:46335296-46335318
Sequence CCGCCTAGACAGTCTTAAGTCTG GTCCGAATTCCAAAGGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96} {0: 1, 1: 4, 2: 63, 3: 120, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!