ID: 1184726875_1184726877

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1184726875 1184726877
Species Human (GRCh38) Human (GRCh38)
Location 22:46352165-46352187 22:46352184-46352206
Sequence CCTTCTTCAGGTGCGTGCTGCTC GCTCTTTGACACAAAGAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 126} {0: 1, 1: 0, 2: 1, 3: 15, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!