ID: 1184729694_1184729704

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1184729694 1184729704
Species Human (GRCh38) Human (GRCh38)
Location 22:46365772-46365794 22:46365811-46365833
Sequence CCCTACCCCTTCTGTGTTCCCAA ACAGCCTCCCGAGTATGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 343} {0: 1, 1: 0, 2: 1, 3: 70, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!