ID: 1184740935_1184740941

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1184740935 1184740941
Species Human (GRCh38) Human (GRCh38)
Location 22:46428764-46428786 22:46428796-46428818
Sequence CCTGGCGCTCCACCTCACTGCCT GCTCACTCACGGGTCCCCAGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!