ID: 1184751326_1184751337

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1184751326 1184751337
Species Human (GRCh38) Human (GRCh38)
Location 22:46488108-46488130 22:46488139-46488161
Sequence CCTGCCCTGCACCTCAGTTTCAG TCTGCAGGCTGACAGCAGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 33, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!