ID: 1184778320_1184778326

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1184778320 1184778326
Species Human (GRCh38) Human (GRCh38)
Location 22:46634143-46634165 22:46634162-46634184
Sequence CCTGCCGAGGGCTGGGGGAGTGT GTGTGGCAGGTTCCCTCGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 222} {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!