ID: 1184779397_1184779402

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1184779397 1184779402
Species Human (GRCh38) Human (GRCh38)
Location 22:46638936-46638958 22:46638968-46638990
Sequence CCCTGTCCTTGGTTACCAGTGCT GTGCGCTCACCTGGTGCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 176} {0: 1, 1: 0, 2: 2, 3: 5, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!