ID: 1184779399_1184779402

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1184779399 1184779402
Species Human (GRCh38) Human (GRCh38)
Location 22:46638942-46638964 22:46638968-46638990
Sequence CCTTGGTTACCAGTGCTCTCATG GTGCGCTCACCTGGTGCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 117} {0: 1, 1: 0, 2: 2, 3: 5, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!