ID: 1184790151_1184790163

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1184790151 1184790163
Species Human (GRCh38) Human (GRCh38)
Location 22:46695227-46695249 22:46695275-46695297
Sequence CCTATCCCTTGGAGATCCCACCG TGTCCCTTCATAGCAGTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 70} {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!