ID: 1184864050_1184864056

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1184864050 1184864056
Species Human (GRCh38) Human (GRCh38)
Location 22:47192746-47192768 22:47192778-47192800
Sequence CCTACCCCTGGATGTGTGGCCTG CCCCTCTTGCCCGCCTGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 302} {0: 1, 1: 0, 2: 2, 3: 40, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!