ID: 1184864070_1184864077

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1184864070 1184864077
Species Human (GRCh38) Human (GRCh38)
Location 22:47192809-47192831 22:47192843-47192865
Sequence CCTGCATTCTAATTGCCGGGACC CGCACCCCCCACCTCTGCCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!