ID: 1184864072_1184864085

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1184864072 1184864085
Species Human (GRCh38) Human (GRCh38)
Location 22:47192824-47192846 22:47192865-47192887
Sequence CCGGGACCCAGCGGCTGTCCGCA GCTCCTCCCTCTGCCCGTAAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!