ID: 1184878353_1184878366

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1184878353 1184878366
Species Human (GRCh38) Human (GRCh38)
Location 22:47289556-47289578 22:47289605-47289627
Sequence CCTCTGGGCTGTGGGCTGGTCTG GCTTGGAGCTGAAGTGGGGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!