ID: 1184891208_1184891215

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1184891208 1184891215
Species Human (GRCh38) Human (GRCh38)
Location 22:47380517-47380539 22:47380553-47380575
Sequence CCAGCACTTTGGGAGGCTGAGGC GAGGCTAGGAGTTTGGGACGAGG
Strand - +
Off-target summary {0: 56931, 1: 168651, 2: 218048, 3: 269456, 4: 306914} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!