ID: 1184947123_1184947125

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1184947123 1184947125
Species Human (GRCh38) Human (GRCh38)
Location 22:47811382-47811404 22:47811405-47811427
Sequence CCTGCTTCTGTGTGTGCTGAGTG TTGACTGGCATGAATCCTTACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 333} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!