ID: 1184959466_1184959483

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1184959466 1184959483
Species Human (GRCh38) Human (GRCh38)
Location 22:47918563-47918585 22:47918606-47918628
Sequence CCAGACTCCCTCCACACCCACAG CCCCACAGATGGTGACTGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 58, 4: 630} {0: 1, 1: 0, 2: 1, 3: 21, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!