ID: 1184979262_1184979266

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1184979262 1184979266
Species Human (GRCh38) Human (GRCh38)
Location 22:48084575-48084597 22:48084596-48084618
Sequence CCGATGGAGCGCAGGATGGTTTT TTGGAGAGCGACTGGTTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 226} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!