ID: 1185000417_1185000425

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1185000417 1185000425
Species Human (GRCh38) Human (GRCh38)
Location 22:48242143-48242165 22:48242164-48242186
Sequence CCTCGCATTCCCAAAGGGGCCCC CCTGGAAAGGAGAGCCCAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 52, 4: 411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!