ID: 1185009838_1185009847

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1185009838 1185009847
Species Human (GRCh38) Human (GRCh38)
Location 22:48306781-48306803 22:48306833-48306855
Sequence CCTGGAGCACAGAAACTGTTCTG ACCCTGATCCCGCCACCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 273} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!