ID: 1185033866_1185033874

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1185033866 1185033874
Species Human (GRCh38) Human (GRCh38)
Location 22:48460717-48460739 22:48460736-48460758
Sequence CCCCACCACCTGCGGGCCAGGTC GGTCGCCTTTCCCAAGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 199} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!