ID: 1185055457_1185055465

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1185055457 1185055465
Species Human (GRCh38) Human (GRCh38)
Location 22:48576406-48576428 22:48576440-48576462
Sequence CCGGCGGGGCGCTGATGCGGCGC CTGCGCGACTTCGGGGGCGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 65} {0: 1, 1: 0, 2: 0, 3: 14, 4: 711}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!