ID: 1185058804_1185058814

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1185058804 1185058814
Species Human (GRCh38) Human (GRCh38)
Location 22:48594909-48594931 22:48594933-48594955
Sequence CCCTTGGGACTGCCCCATGTCCC AGCACACCTTCGGCTGAGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!