ID: 1185068157_1185068161

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1185068157 1185068161
Species Human (GRCh38) Human (GRCh38)
Location 22:48642242-48642264 22:48642255-48642277
Sequence CCAGAGCCCCAGGGGACCCCAGA GGACCCCAGAACCTCCCAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 68, 4: 494} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!