ID: 1185094379_1185094385

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1185094379 1185094385
Species Human (GRCh38) Human (GRCh38)
Location 22:48798419-48798441 22:48798434-48798456
Sequence CCAAAGCCAGCGCGCCCCAGAGC CCCAGAGCTGCCTAACGTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 149} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!