ID: 1185138403_1185138408

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1185138403 1185138408
Species Human (GRCh38) Human (GRCh38)
Location 22:49086843-49086865 22:49086857-49086879
Sequence CCCAGGAGGCCGTCGGGGAGAGG GGGGAGAGGCCGGTGCTGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 187} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!