ID: 1185155775_1185155782

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1185155775 1185155782
Species Human (GRCh38) Human (GRCh38)
Location 22:49192574-49192596 22:49192625-49192647
Sequence CCCTGTTGTTCAGGGAAACAGGT TGGGGCTCAAAGTGTGAGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 29, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!