ID: 1185208382_1185208392

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1185208382 1185208392
Species Human (GRCh38) Human (GRCh38)
Location 22:49553196-49553218 22:49553211-49553233
Sequence CCTCGGGCACAGCCCTGTGGGCA TGTGGGCAGGGAGGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 215} {0: 1, 1: 4, 2: 31, 3: 305, 4: 2578}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!