ID: 1185211568_1185211579

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1185211568 1185211579
Species Human (GRCh38) Human (GRCh38)
Location 22:49573502-49573524 22:49573541-49573563
Sequence CCAGGCTCACCTGGGACATGGAG AGCAAGGCCCAGAGTGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 272} {0: 1, 1: 1, 2: 11, 3: 68, 4: 603}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!