ID: 1185244540_1185244554

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1185244540 1185244554
Species Human (GRCh38) Human (GRCh38)
Location 22:49766019-49766041 22:49766065-49766087
Sequence CCGCCCCACTGCAGGTGGGCCTG TTGGGAGGAAATGGCCACCCGGG
Strand - +
Off-target summary {0: 5, 1: 1, 2: 7, 3: 44, 4: 440} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!