ID: 1185255092_1185255109

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1185255092 1185255109
Species Human (GRCh38) Human (GRCh38)
Location 22:49827468-49827490 22:49827497-49827519
Sequence CCTCCCCGGCCAGGCCCCCGCCC CTTCGGGGCGCCGCGGCCGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 22, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!