ID: 1185259262_1185259272

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1185259262 1185259272
Species Human (GRCh38) Human (GRCh38)
Location 22:49852898-49852920 22:49852938-49852960
Sequence CCATAGAAAACCCGGCTGCAGGC ACAGTCGGCGTGCGGGTGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 117} {0: 1, 1: 0, 2: 1, 3: 2, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!