ID: 1185266264_1185266279

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1185266264 1185266279
Species Human (GRCh38) Human (GRCh38)
Location 22:49905967-49905989 22:49906011-49906033
Sequence CCCCCAGGACTGTCTCAAGGCCC ACGGCCTGCTCTTGCTCCCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!