ID: 1185266925_1185266931

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1185266925 1185266931
Species Human (GRCh38) Human (GRCh38)
Location 22:49909129-49909151 22:49909167-49909189
Sequence CCTGCAGCCACGCTGCAGAGAAG TCCACTGCCCATGGAGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 25, 4: 248} {0: 1, 1: 0, 2: 0, 3: 29, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!