ID: 1185269824_1185269829

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1185269824 1185269829
Species Human (GRCh38) Human (GRCh38)
Location 22:49924279-49924301 22:49924294-49924316
Sequence CCGGTGCCTTGTGCATGTCGGGG TGTCGGGGTCTGACGGGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 87} {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!