ID: 1185270431_1185270439

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1185270431 1185270439
Species Human (GRCh38) Human (GRCh38)
Location 22:49927072-49927094 22:49927105-49927127
Sequence CCTCATCTCTCATCTGCTTTGTG GTCTCCGAGCTGCCCTTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 438} {0: 1, 1: 0, 2: 0, 3: 10, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!