ID: 1185272678_1185272692

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1185272678 1185272692
Species Human (GRCh38) Human (GRCh38)
Location 22:49936050-49936072 22:49936086-49936108
Sequence CCTGCAGCCCGTGCCCAGCCCCA GCGCTCCTCCCCCGCCGCCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 48, 4: 462}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!