ID: 1185278610_1185278624

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1185278610 1185278624
Species Human (GRCh38) Human (GRCh38)
Location 22:49960622-49960644 22:49960659-49960681
Sequence CCAAGCTGCCCCGCCGTCTCCCC CGCCGCCGCCTCGCGGGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 386} {0: 1, 1: 1, 2: 10, 3: 64, 4: 463}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!