ID: 1185292497_1185292508

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1185292497 1185292508
Species Human (GRCh38) Human (GRCh38)
Location 22:50034241-50034263 22:50034292-50034314
Sequence CCTTCCCTGTGGTGCTGTGGGCC GCATCAAGTGTGGCCGTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 125, 4: 427} {0: 1, 1: 0, 2: 0, 3: 8, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!