ID: 1185294084_1185294096

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1185294084 1185294096
Species Human (GRCh38) Human (GRCh38)
Location 22:50044890-50044912 22:50044924-50044946
Sequence CCCACGGGGCCCCTTTGGGGAGA GCATCGTGGTGGCCGTGGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 13, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!