ID: 1185299895_1185299896

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1185299895 1185299896
Species Human (GRCh38) Human (GRCh38)
Location 22:50074102-50074124 22:50074124-50074146
Sequence CCTCTGTGGTGACTCTCTGTCTG GAATGCACCAAGACTGAGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 424} {0: 1, 1: 0, 2: 0, 3: 8, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!