ID: 1185310740_1185310746

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1185310740 1185310746
Species Human (GRCh38) Human (GRCh38)
Location 22:50152881-50152903 22:50152913-50152935
Sequence CCAAGGGCTTGGTCTGGGGGCAG AGGGGCGCAGGAGCAGAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 348} {0: 1, 1: 0, 2: 3, 3: 22, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!